Immunocytochemistry Cells were fixed at room temperature wit

Immunocytochemistry. Cells were fixed at room temperature with 4% paraformaldehyde for 10min. Non-specific proteins were blocked by ultra V block (Thermo). The cells were then treated with primary purchase LJI308 overnight at 4°C. Primary antibodies were against TRA-1-60 (1:500, MA1-023, Thermo Fisher), OCT4 (1:500, C30A3, Cell Signalling), and SSEA3 (1:100, MAB4303, Millipore). After washing with PBS, the cells were incubated with fluorescence-conjugated secondary antibody AlexaFluor 488: donkey anti-goat (1:500, A11055, Life Technologies), goat anti-mouse (1:500, A21042, Life Technologies), and goat anti-rat (1:500, A21212, Life Technologies) for 45min, and finally mounted to cover-slip with Vectashield mounting medium with DAPI (Vectorlabs). Quantitative polymerase chain reaction (qPCR). Total RNA was extracted using RNA Spin II (Macherey-Nagel) by following the manufacturer\'s instructions. Briefly, first-strand cDNA was synthesized from 2μg total RNA by SuperScript III reverse transcriptase (Invitrogen) with oligo dT primer (Invitrogen) in 20μl volume. 1% of above cDNA was used for each qPCR reaction in a 20μl mixture containing 10μl of SYBR green-Taq mixed solution (Sigma) and 5μl of 2μM-primer mix. PCR reactions were carried out in a Corbette thermal cycler (Qiagen) for 40 cycles and each cycle contained 95°C for 15s, 60°C for 30s and 72°C for 30s. RNA without reverse transcription was used as a negative control. The relative expression level of genes was calculated by calibrating their CT values with that of the housekeeping gene Cyclophilin G. Primer sequences (5′→3′) were as follows: OCT4_endoF: TTGGGCTCGAGAAGGATGTG; OCT4_endoR: TCCTCTCGTTGTGCATAGTCG; SOX2_endoF: GCCCTGCAGTACAACTCCAT SOX2_endoR: TGCCCTGCTGCGAGTAGGA; NANOG-F: CTCAGCCTCCAGCAGATGC; NANOG-R: TAGATTTCATTCTCTGGTTCTGG; TDGF1-F: TCAGAGATGACAGCATTTGGC; TDGF1-R: TTCAGGCAGCAGGTTCTGTTTA; SeV-F: GGATCACTAGGTGATATCGAGC; SeV-R: ACCAGACAAGAGTTTAAGAGATATGTATC; GAPDH-F: GGTCATCCATGACAACTTTGG; GAPDH-R: TGAGCTTCCCGTTCAGCTC Demonstration of three germ layer differentiation capacity. About 200,000 morphologically intact iPSC were intratesticularly injected into male NMRI nude mice (Scanbur). The resulting tumors were collected 8weeks after injection, fixed with 10% formalin, and hematoxylin and eosin stained. The experimental animal welfare committee of the District Government of Southern Finland approved the animal experiments. Verification and authentication. Chromosomal G-band analyses were performed at the Yhtyneet Medix laboratoriot, Finland (http://www.yml.fi/). Cell line authentication has been done with StemEliteTM ID system (Promega) by Genomic Unit of Technology Centre, Institute for Molecular medicine Finland (FIMM).
Introduction Oligodendrocytes are one of the major cell types in the cerebral white matters. They produce a lipid-rich membrane called myelin, which enwrap up to 60 axonal segments each (i.e. myelin sheath). Myelin sheaths enable effective nerve impulse conduction and play a supporting role for axons and neuron homeostasis (Baumann and Pham-Dinh, 2001). During development, oligodendrocyte precursor cells (OPCs) are generated from germinal zones, then proliferate and migrate to both gray and white matter areas, where most of them differentiate into mature oligodendrocytes and form myelin sheaths. However, some OPCs may persist in an immature state. These residual OPCs are widely distributed in adult brains, comprising 5–8% of all cells (Levine et al., 2001). Although myelinated tracts are formed early in life, renewal of myelin and oligodendrocyte continues throughout most of the adult life (Paus et al., 1999; Young et al., 2013; Dimou et al., 2008). In fact, myelin sheaths in the adult CNS exhibit some plasticity in response to changes in neural activity (Scholz et al., 2009) and brain injury (Nait-Oumesmar et al., 2008). Residual OPCs may play an important part in these endogenous mechanisms of white matter repair and renewal.